==================================================================== Motifs: representing them and searching for hits against a reference ==================================================================== :Date: 2025-09-24 .. contents:: :depth: 2 .. .. raw:: html Background ========== DNA-binding proteins, called transcription factors (TFs), play key roles in gene expression regulation, including the regulation of cellular functions and during organismal development. The TF binding sites (TFBSs) tend to be in the range of 6-12 base pairs (bp) long `(Spitz and Furlong, 2012) `__. The effect of their binding can be indirectly observed via associated changes in transcription, chromatin accessibility, DNA methylation and histone modifications. Here, we will examine how the TFBSs, also called motifs, can be represented in the form of nucleotide (rows) x position (columns) matrices, such as the position weight matrix (PWM). We will learn how such matrices can be created, downloaded from public databases like Jaspar, and use them to scan against a reference sequence in search for predicted motif hits. Learning outcomes ================= - Understand how motifs can be represented in nucleotide x sequence position matrices. - Understand the differences between the position frequency matrix (PFM), position probability matrix (PPM), position weight matrix (PWM), and information content matrix (ICM), and learn how these matrices can be constructed. - Learn how to load PWMs in ``R`` and scan for motif hits against a reference. Libraries ========= We start by loading the needed packages. If necessary, use ``BiocManager::install()`` to install missing packages. Note that we will need to work with the latest version of ``monaLisa`` if using ``ggplo2>=4.0.0``. .. container:: cell .. code:: r suppressPackageStartupMessages({ library(TFBSTools) library(Biostrings) library(JASPAR2024) library(RSQLite) library(BSgenome.Mmusculus.UCSC.mm39) library(TxDb.Mmusculus.UCSC.mm39.knownGene) library(GenomicRanges) library(monaLisa) }) # ## To install the latest tool versions, and from the current bioconductor release (3.21) # pkgs <- c("TFBSTools", "Biostrings", "JASPAR2024", "RSQLite", # "BSgenome.Mmusculus.UCSC.mm39", "TxDb.Mmusculus.UCSC.mm39.knownGene", # "GenomicRanges", "monaLisa") # bioc <- "3.21" # with R 4.5 # #libPath <- "/path/to/custom/folder/if/desired" # BiocManager::install(pkgs = pkgs, # update = TRUE, # ask = TRUE, # checkBuilt = FALSE, # force = FALSE, # # lib = libPath, # version = bioc) # ## if you need to install a specific version of a package you can do so as follows # remotes::install_version("ggplot2", version = "3.5.2") Motif databases =============== As mentioned, TFBSs or motifs can be represented in matrices with rows corresponding to the nucleotides, namely :math:`A`, :math:`C`, :math:`G`, and :math:`T`, and columns corresponding to the position along the binding site. The position frequency matrix (PFM), also called the position count matrix (PCM), shows the count each nucleotide contributes at a particular position. Such matrices can be obtained from publicly available databases like `Jaspar `__ (`Sandelin et al. `__) and `Hocomoco `__ (`Vorontsov, Eliseeva, Zinkevich, et al. `__). In this tutorial we will focus on Jaspar, which is also available as Bioconductor packages like `JASPAR2024 `__. .. raw:: html `Jaspar `__ is an open-access database that provides TF binding preferences in the form of position frequency matrices (PFMs). PFMs are generated by aligning DNA binding-site sequences from high-quality experiments such as ChIP-seq, protein binding microarrays, and SELEX-based methods, along with incorporating curated external motifs. More details about this can be found on the Jaspar `website `__. Position frequency matrix ========================= As stated, the PFM depicts the frequencies of the nucleotides i.e. the number of times each nucleotide occurs at each position along the motif. Note that the motif positions are independent of one another in this representation. To illustrate this more we will use the CTCFL motif as an example by reading in the DNA sequences which we have downloaded from `Jaspar `__ and producing the corresponding PFM. We will use the ``Biostrings`` package to read the sequences and represent them as a ``DNAStringSet`` object, which is a convenient way to represent and manipulate DNA sequences in ``R``. See the `vignette `__ from the ``Biostrings`` package for more details. Let’s set up our working directory and download the data. .. container:: cell .. code:: bash # go to your working directory and make a data folder mkdir data # option A: download the file from Jaspar wget -P data https://jaspar.elixir.no/download/data/2024/sites/MA1102.3.sites # option B: download the file from GitHub wget -P data https://github.com/NBISweden/workshop-epigenomics-RTDs/blob/master/docs/content/tutorials/motifAnalyses/data/MA1102.3.sites .. container:: cell .. code:: r # read in the TFBS sequences CTCFLsequencesFile <- "data/MA1102.3.sites" CTCFLsequences <- readDNAStringSet(CTCFLsequencesFile) CTCFLsequences .. container:: cell-output cell-output-stdout :: DNAStringSet object of length 18037: width seq names [1] 8 CAGGGGGC hg38_chr1:869925-... [2] 8 CAGGGGGC hg38_chr1:904775-... [3] 8 GAGGGGGC hg38_chr1:925040-... [4] 8 CAGGGGGC hg38_chr1:945418-... [5] 8 GAGGGGGC hg38_chr1:951563-... ... ... ... [18033] 8 AAGGGGGC hg38_chrX:1550575... [18034] 8 GAGGGGGC hg38_chrX:1552166... [18035] 8 CAGGGGGA hg38_chrX:1552168... [18036] 8 CAGGGGGC hg38_chrX:1554355... [18037] 8 GAGGGGGC hg38_chrX:1556122... We can see that we have a total of 18037 sequences of the TF binding site. Next, we generate the PFM by counting the nucleotide occurrences per position. .. container:: cell .. code:: r # create PFM by counting nucleotide occurrences per position pfm <- consensusMatrix(CTCFLsequences) pfm <- pfm[c("A", "C", "G", "T"), ] pfm .. container:: cell-output cell-output-stdout :: [,1] [,2] [,3] [,4] [,5] [,6] [,7] [,8] A 1301 17270 86 684 349 193 351 181 C 12867 413 481 600 1141 767 270 17593 G 2033 329 17285 16511 15425 16819 17001 68 T 1836 25 185 242 1122 258 415 195 Position probability matrix =========================== We can now calculate the probability of observing each nucleotide at a particular position by dividing counts by the total count per position. .. math:: PPM_{ij} = \frac{count_{ij}}{\sum_{i}{count_{ij}}} Where :math:`i` is the nucleotide and :math:`i \in \{A, C, G, T\}`, and :math:`j` is the position along the motif. .. container:: cell .. code:: r # calculate PPM ppm <- sweep(x = pfm, MARGIN = 2, STATS = colSums(pfm), FUN = "/") ppm .. container:: cell-output cell-output-stdout :: [,1] [,2] [,3] [,4] [,5] [,6] [,7] A 0.07212951 0.95747630 0.004767977 0.03792205 0.01934912 0.01070023 0.01946000 C 0.71336697 0.02289738 0.026667406 0.03326496 0.06325886 0.04252370 0.01496923 G 0.11271276 0.01824028 0.958307923 0.91539613 0.85518656 0.93247214 0.94256251 T 0.10179076 0.00138604 0.010256695 0.01341687 0.06220547 0.01430393 0.02300826 [,8] A 0.010034928 C 0.975383933 G 0.003770028 T 0.010811110 .. code:: r # all positions now sum to 1 colSums(ppm) .. container:: cell-output cell-output-stdout :: [1] 1 1 1 1 1 1 1 1 Now we can calculate the probability of observing a certain motif sequence by multiplying the probabilities of each nucleotide per position. Let us look at some examples below. .. container:: cell .. code:: r p_CAGACGGC <- ppm["C", 1] * ppm["A", 2] * ppm["G", 3] * ppm["A", 4] * ppm["C", 5] * ppm["G", 6] * ppm["G", 7] * ppm["C", 8] p_CAGACGGC .. container:: cell-output cell-output-stdout :: C 0.001346111 .. code:: r p_AATTGGTT <- ppm["A", 1] * ppm["A", 2] * ppm["T", 3] * ppm["T", 4] * ppm["G", 5] * ppm["G", 6] * ppm["T", 7] * ppm["T", 8] p_AATTGGTT .. container:: cell-output cell-output-stdout :: A 1.885169e-09 In this PPM, we do not have any zero counts for any given nculeotide and position. What would happen if we did? Let us suppose that ``pfm["T", 7]`` had a count of zero and therefore ``ppm["T", 7]`` is also zero. Multiplying by zero would result in ``p_AATTGGTT = 0``. This issue can especially emerge when starting from a low number of sequences to construct the PFM. To avoid low count issues, we will add a peudo-count :math:`p` of 1 per position, to the PFM. This corresponds to a pseudo-count of :math:`p/N` for each entry in the matrix, where :math:`N` is the total number of nucleotides, and :math:`N=4` in our case. We will then re-calculate the PPM. .. math:: PPM_{ij} = \frac{count_{ij}+\frac{p}{N}}{\sum_{i}{count_{ij}+p}} .. container:: cell .. code:: r # set p and N pseudooCount <- 1 N <- nrow(pfm) # add pseudo-count to PFM and re-calculate PPM pfmWithPseudo <- pfm + pseudooCount/N ppm <- sweep(x = pfmWithPseudo, MARGIN = 2, STATS = colSums(pfm), FUN = "/") ppm .. container:: cell-output cell-output-stdout :: [,1] [,2] [,3] [,4] [,5] [,6] [,7] A 0.07214337 0.95749016 0.004781837 0.03793591 0.01936298 0.01071409 0.01947386 C 0.71338083 0.02291124 0.026681266 0.03327882 0.06327272 0.04253756 0.01498309 G 0.11272662 0.01825414 0.958321783 0.91540999 0.85520042 0.93248600 0.94257637 T 0.10180462 0.00139990 0.010270555 0.01343073 0.06221933 0.01431779 0.02302212 [,8] A 0.010048789 C 0.975397793 G 0.003783889 T 0.010824971 Position weight matrix ====================== The position weight matrix (PWM) is also known as the position-specific scoring matrix or the logodds scoring matrix. Here, log-odds scores are calculated by comparing the probabilities we have in the PPM to the probabilities of observing each nucleotide outside of a binding site (background nucleotide probabilities). Assuming a uniform background, in which each nucleotide has an equal probability, would give us the following background probabilities for each nucleotide: :math:`p(A) = p(C) = p(G) = p(T) = 0.25`. The log-odds scores can be obtained as follows: .. math:: PWM_{ij}=log_2\Bigl(\frac{PPM_{ij}}{B_i}\Bigr) Where :math:`i` is the nucleotide, :math:`j` is the position along the motif, and :math:`B_i` is the background probability for nucleotide :math:`i`. Thanks to the pseudo-count we have added, we will avoid situations where we are taking the :math:`log_2(0)` which is :math:`-Inf`. .. container:: cell .. code:: r # define background probabilities (B <- c("A" = 0.25, "C" = 0.25, "G" = 0.25, "T" = 0.25)) .. container:: cell-output cell-output-stdout :: A C G T 0.25 0.25 0.25 0.25 .. code:: r # calculate PWM pwm <- log2(sweep(x = ppm, MARGIN = 2, STATS = B, FUN = "/")) pwm .. container:: cell-output cell-output-stdout :: [,1] [,2] [,3] [,4] [,5] [,6] [,7] A -1.792989 1.937330 -5.708219 -2.720292 -3.690555 -4.544347 -3.682317 C 1.512744 -3.447801 -3.228029 -2.909252 -1.982273 -2.555119 -4.060521 G -1.149100 -3.775632 1.938582 1.872490 1.774334 1.899154 1.914681 T -1.296125 -7.480460 -4.605342 -4.218319 -2.006493 -4.126047 -3.440835 [,8] A -4.636835 C 1.964063 G -6.045915 T -4.529493 The score for a specific sequence can now be calculated by combining the PWM scores at each position. For example the score for ``CAGACGGC`` is: .. container:: cell .. code:: r pwm["C", 1] + pwm["A", 2] + pwm["G", 3] + pwm["A", 4] + pwm["C", 5] + pwm["G", 6]+ pwm["G", 7] + pwm["C", 8] .. container:: cell-output cell-output-stdout :: C 6.463989 In this manner, PWMs can be used to scan for motif matches against a reference DNA sequence. The ``matchPWM`` function from the ``Biostrings`` can be used to do that. Matches with scores greater that the set ``min.score`` will be called as predicted binding sites. ``min.score`` can be set as a fixed empiric number or as a character reflecting the percentage of the highest possible score. See the ``matchPWM`` function for more details. Let us try scanning for this motif against a given DNA string. .. container:: cell .. code:: r # reference DNA sequence (this is typically the reference genome) refDNA <-"GCCTATACAGACGGCGTTGGATATACGCAGACGGCTGTGA" matchPWM(pwm, subject = refDNA, min.score = 6) .. container:: cell-output cell-output-stdout :: Views on a 40-letter DNAString subject subject: GCCTATACAGACGGCGTTGGATATACGCAGACGGCTGTGA views: start end width [1] 8 15 8 [CAGACGGC] [2] 28 35 8 [CAGACGGC] .. container:: .. **Exercise** Using the PWM we have created, calculate the score for sequence ``CAGGGGGC``. Then, using the ``matchPWM`` function and setting ``min.score=10``, find the motif matches in the following reference sequence: ``GGCAGGGGGCTGCCCCGACAGACGGCCTAGGTATGCTGTTCCCACAGGGGGCTCTTCCGGGGTGTCAGGGGGCTT``. .. raw:: html
Show solution .. container:: cell .. code:: r # reference DNA sequence (this is typically the reference genome) refDNA <- "GGCAGGGGGCTGCCCCGACAGACGGCCTAGGTATGCTGTTCCCACAGGGGGCTCTTCCGGGGTGTCAGGGGGCTT" matchPWM(pwm, subject = refDNA, min.score = 10) .. container:: cell-output cell-output-stdout :: Views on a 75-letter DNAString subject subject: GGCAGGGGGCTGCCCCGACAGACGGCCTAGGTAT...CCACAGGGGGCTCTTCCGGGGTGTCAGGGGGCTT views: start end width [1] 3 10 8 [CAGGGGGC] [2] 45 52 8 [CAGGGGGC] [3] 66 73 8 [CAGGGGGC] .. raw:: html
| Information content matrix ========================== The information content matrix (ICM) can additionally reflect which positions along the motif are more or less conserved. To have a better understanding of this, we need to first introduce some key concepts in information theory, a field established by Claude Shannon with his influential publication in 1948, entitled `“A Mathematical Theory of Communication” `__. We will largely borrow explanations from David McKay’s book “Information Theory, Inference, and Learning Algorithms”, which offers great explanations and deeper dives into the topic for those interested. Let us consider a random variable :math:`X` with an outcome :math:`x`. The **Shannon information content** of :math:`x` is defined as :math:`h(x)=log_2\frac{1}{p(x)}`, where :math:`p(x)` is the probability of outcome :math:`x`. It is measured in bits since we are using :math:`log_2`, and reflects a measure of surprise from an outcome. For example, an outcome with probability of 1 is not very surprising and thus provides no information if observed: :math:`log_2(1)=0`. Whereas an outcome with a very low probability is more surprising and provides more information were it to happen. For example, assume the following probabilities of observing the outcome of a random variable :math:`X`: :math:`p(x=0)=0.4` and :math:`p(x=1)=0.6`. You could imagine a bent coin with binary outcomes. The Shannon information content for outcome :math:`x=0` is :math:`h(x=0)=log_2\frac{1}{p(x=0)}=log_2\frac{1}{0.4}\approx1.322`. The **entropy** represents the average Shannon information content of an outcome and is: .. math:: H(X)=\sum_{x}p(x)log_2\frac{1}{p(x)} Following our example from above, the entropy of :math:`X` is .. math:: \begin{aligned} H(X) &= \sum_{x}p(x)log_2\frac{1}{p(x)} \\ &= p(x=0)log_2\frac{1}{p(x=0)} + p(x=1)log_2\frac{1}{p(x=1)} \\ &= 0.4log_2\frac{1}{0.4} + 0.6log_2\frac{1}{0.6} \\ &\approx 0.971 \end{aligned} We can think of it as an average measure of surprise. Another name for the entropy is the uncertainty. You may notice that it is maximized when we have uniform probabilities. Coming back to our motif, we want to calculate the bits per position, and use that to reflect the degree of conservation of the positions. We calculate this by taking the maximum uncertainty per position and subtracting the actual uncertainty at that position. As mentioned, uncertainty (entropy) is maximum when all outcomes have equal probabilities. In our case, the outcome is the specific instance of a nucleotide. We thus have 4 outcomes (:math:`A`, :math:`C`, :math:`G`, and :math:`T`). In a scenario, where all nucleotides are equally likely, there is no *preference* for any particular nucleotide. Assuming equal probabilities of :math:`\frac{1}{N}` for each nucleotide, where :math:`N` is the total number of nucleotides, the maximum entropy, or total information content :math:`IC_{total}`, can be calculated as follows: .. math:: \begin{aligned} IC_{total} &= \sum_{x}p(x)log_2\frac{1}{p(x)} \\ &= N*\frac{1}{N}log_2N \\ &= log_2N \\ &= log_24 \\ &= 2 \end{aligned} The actual uncertainty :math:`U` per position is .. math:: \begin{aligned} U &= \sum_{x}p(x)log_2\frac{1}{p(x)} \\ &= -\sum_{x}p(x)log_2p(x) \end{aligned} \ The final information content :math:`IC_{final}` per position is: .. math:: \begin{aligned} IC_{final} &= IC_{total}-U \\ &= 2-U \end{aligned} When :math:`U=0` (when one nucleotide has a probability of 1), :math:`IC_{final}=2-0=2` and you know the nucleotide with no uncertainty. This reflects a highly conserved nucleotide. Following our example motif, let us calculate :math:`IC_{final}` for each position. .. container:: cell .. code:: r # total information content (maximum uncertainty) IC_total <- log2(4) IC_total .. container:: cell-output cell-output-stdout :: [1] 2 .. code:: r # actual uncertainty per position U <- -colSums(apply(X = ppm, MARGIN = 2, FUN = function(x){ x*log2(x) })) U .. container:: cell-output cell-output-stdout :: [1] 1.3117860 0.3035231 0.3030486 0.5426832 0.8044259 0.4456293 0.4071408 [8] 0.2028718 .. code:: r # final information content per position IC_final <- IC_total - U IC_final .. container:: cell-output cell-output-stdout :: [1] 0.688214 1.696477 1.696951 1.457317 1.195574 1.554371 1.592859 1.797128 Finally, to get the ICM where the height of each nulceotide (letter) shows the bits each nucleotide contributes, we will multiply the probability of each nucleotide by :math:`IC_{final}` per position. .. container:: cell .. code:: r # ICM icm <- sweep(x = ppm, MARGIN = 2, STATS = IC_final, FUN = "*") icm .. container:: cell-output cell-output-stdout :: [,1] [,2] [,3] [,4] [,5] [,6] A 0.04965008 1.624359931 0.008114546 0.05528464 0.02314987 0.01665366 C 0.49095866 0.038868386 0.045276813 0.04849778 0.07564722 0.06611914 G 0.07758003 0.030967734 1.626225532 1.33404237 1.02245549 1.44942889 T 0.07006336 0.002374898 0.017428633 0.01957282 0.07438782 0.02225515 [,7] [,8] A 0.03101912 0.018058961 C 0.02386595 1.752914869 G 1.50139141 0.006800133 T 0.03667100 0.019453860 .. code:: r # create ICMatrix object to use the seqLogo function from TFBSTools icmatrix <- ICMatrix(ID = "MA1102.3", name = "CTCFL", profileMatrix = icm) icmatrix .. container:: cell-output cell-output-stdout :: An object of class ICMatrix ID: MA1102.3 Name: CTCFL Matrix Class: Unknown strand: + Pseudocounts: Schneider correction: Tags: list() Background: A C G T 0.25 0.25 0.25 0.25 Matrix: [,1] [,2] [,3] [,4] [,5] [,6] A 0.04965008 1.624359931 0.008114546 0.05528464 0.02314987 0.01665366 C 0.49095866 0.038868386 0.045276813 0.04849778 0.07564722 0.06611914 G 0.07758003 0.030967734 1.626225532 1.33404237 1.02245549 1.44942889 T 0.07006336 0.002374898 0.017428633 0.01957282 0.07438782 0.02225515 [,7] [,8] A 0.03101912 0.018058961 C 0.02386595 1.752914869 G 1.50139141 0.006800133 T 0.03667100 0.019453860 .. code:: r # draw motif sequence logo seqLogo(icmatrix) .. container:: cell-output-display |image1| This is a useful way to visualize motifs, and get a sense of how conserved the sequence is at each position. Scanning for motif hits ======================= Now that we have a good understanding of the PWM and the other matrices, let us see how we can load a list of PWMs from Jaspar and what useful functions are at our disposal. We will extract the list of all vertebrate TFs. .. container:: cell .. code:: r # extract PFMs of vertebrate TFs from JASPAR2024 JASPAR2024 <- JASPAR2024() JASPARConnect <- RSQLite::dbConnect(RSQLite::SQLite(), db(JASPAR2024)) pfmList <- TFBSTools::getMatrixSet(JASPARConnect, opts = list(tax_group = "vertebrates", collection="CORE", matrixtype = "PFM") ) pfmList .. container:: cell-output cell-output-stdout :: PFMatrixList of length 879 names(879): MA0004.1 MA0069.1 MA0071.1 MA0074.1 ... MA1721.2 MA1602.2 MA1722.2 .. code:: r pfmList[[1]] .. container:: cell-output cell-output-stdout :: An object of class PFMatrix ID: MA0004.1 Name: Arnt Matrix Class: Basic helix-loop-helix factors (bHLH) strand: + Tags: $alias [1] "HIF-1beta,bHLHe2" $description [1] "aryl hydrocarbon receptor nuclear translocator" $family [1] "PAS domain factors" $medline [1] "7592839" $remap_tf_name [1] "ARNT" $symbol [1] "ARNT" $tax_group [1] "vertebrates" $tfbs_shape_id [1] "11" $type [1] "SELEX" $unibind [1] "1" $collection [1] "CORE" $species 10090 "Mus musculus" $acc [1] "P53762" Background: A C G T 0.25 0.25 0.25 0.25 Matrix: [,1] [,2] [,3] [,4] [,5] [,6] A 4 19 0 0 0 0 C 16 0 20 0 0 0 G 0 1 0 20 0 20 T 0 0 0 0 20 0 .. code:: r # we can convert the PFMs to PWMs pwmList <- toPWM(pfmList) pwmList[[1]]@profileMatrix .. container:: cell-output cell-output-stdout :: [,1] [,2] [,3] [,4] [,5] [,6] A -0.3081223 1.884523 -4.700440 -4.700440 -4.700440 -4.700440 C 1.6394103 -4.700440 1.957772 -4.700440 -4.700440 -4.700440 G -4.7004397 -2.115477 -4.700440 1.957772 -4.700440 1.957772 T -4.7004397 -4.700440 -4.700440 -4.700440 1.957772 -4.700440 .. code:: r # Alternatively, we can directly load the PWMs pwmList <- TFBSTools::getMatrixSet(JASPARConnect, opts = list(tax_group = "vertebrates", collection="CORE", matrixtype = "PWM") ) pwmList[[1]]@profileMatrix .. container:: cell-output cell-output-stdout :: [,1] [,2] [,3] [,4] [,5] [,6] A -0.3081223 1.884523 -4.700440 -4.700440 -4.700440 -4.700440 C 1.6394103 -4.700440 1.957772 -4.700440 -4.700440 -4.700440 G -4.7004397 -2.115477 -4.700440 1.957772 -4.700440 1.957772 T -4.7004397 -4.700440 -4.700440 -4.700440 1.957772 -4.700440 .. code:: r # pwmList is a PWMatrixList object # we can look at the structure and information available for the first motif str(pwmList[[1]]) .. container:: cell-output cell-output-stdout :: Formal class 'PWMatrix' [package "TFBSTools"] with 8 slots ..@ pseudocounts : num 0.8 ..@ ID : chr "MA0004.1" ..@ name : chr "Arnt" ..@ matrixClass : chr "Basic helix-loop-helix factors (bHLH)" ..@ strand : chr "+" ..@ bg : Named num [1:4] 0.25 0.25 0.25 0.25 .. ..- attr(*, "names")= chr [1:4] "A" "C" "G" "T" ..@ tags :List of 13 .. ..$ alias : chr "HIF-1beta,bHLHe2" .. ..$ description : chr "aryl hydrocarbon receptor nuclear translocator" .. ..$ family : chr "PAS domain factors" .. ..$ medline : chr "7592839" .. ..$ remap_tf_name: chr "ARNT" .. ..$ symbol : chr "ARNT" .. ..$ tax_group : chr "vertebrates" .. ..$ tfbs_shape_id: chr "11" .. ..$ type : chr "SELEX" .. ..$ unibind : chr "1" .. ..$ collection : chr "CORE" .. ..$ species : Named chr "Mus musculus" .. .. ..- attr(*, "names")= chr "10090" .. ..$ acc : chr "P53762" ..@ profileMatrix: num [1:4, 1:6] -0.308 1.639 -4.7 -4.7 1.885 ... .. ..- attr(*, "dimnames")=List of 2 .. .. ..$ : chr [1:4] "A" "C" "G" "T" .. .. ..$ : NULL .. code:: r # we can access some entries with the functions shown below on an example # PWMatrix, but they can also be used on the PWMatrixList motif <- pwmList[[1]] # ... motif name name(motif) .. container:: cell-output cell-output-stdout :: [1] "Arnt" .. code:: r # ... motif ID ID(motif) .. container:: cell-output cell-output-stdout :: [1] "MA0004.1" .. code:: r # ... used background probabilities bg(motif) .. container:: cell-output cell-output-stdout :: A C G T 0.25 0.25 0.25 0.25 .. code:: r # ... motif tags tags(motif) .. container:: cell-output cell-output-stdout :: $alias [1] "HIF-1beta,bHLHe2" $description [1] "aryl hydrocarbon receptor nuclear translocator" $family [1] "PAS domain factors" $medline [1] "7592839" $remap_tf_name [1] "ARNT" $symbol [1] "ARNT" $tax_group [1] "vertebrates" $tfbs_shape_id [1] "11" $type [1] "SELEX" $unibind [1] "1" $collection [1] "CORE" $species 10090 "Mus musculus" $acc [1] "P53762" .. code:: r # disconnect Db dbDisconnect(JASPARConnect) As we have seen, PWMs can be used to scan for potential TFBSs against a reference sequence. To illustrate this, let us use some of the PWMs we have loaded from Jaspar above, to scan against hits at the gene promoters from the UCSC mouse reference genome. We will use the ``findMotifHits`` function from the ``monaLisa`` package to scan for motif hits. This function uses ``Biostrings::matchPWM`` internally to scan for matches, but additionally allows for the ``subject`` argument to accept ``DNAStringSet`` or ``GRanges`` objects. It also allows for parallelization across PWMs with the ``BPPARAM`` argument. .. container:: cell .. code:: r # get promoters as GRanges object promoters <- trim(promoters(TxDb.Mmusculus.UCSC.mm39.knownGene, upstream = 1000, downstream = 500)) .. container:: cell-output cell-output-stderr :: Warning in valid.GenomicRanges.seqinfo(x, suggest.trim = TRUE): GRanges object contains 1 out-of-bound range located on sequence chr1_GL456210v1_random. Note that ranges located on a sequence whose length is unknown (NA) or on a circular sequence are not considered out-of-bound (use seqlengths() and isCircular() to get the lengths and circularity flags of the underlying sequences). You can use trim() to trim these ranges. See ?`trim,GenomicRanges-method` for more information. .. code:: r # extract promoter sequences promoterSeqs <- getSeq(BSgenome.Mmusculus.UCSC.mm39, promoters) promoterSeqs .. container:: cell-output cell-output-stdout :: DNAStringSet object of length 278375: width seq names [1] 1500 CCCTTTTGGATAGATTCTAGG...GATTTATGAGTAAGGGATGT ENSMUST00000193812.2 [2] 1500 TTCTGAGGAGAGTGGCTCATA...AGGTAGCAACAGATATGGCA ENSMUST00000082908.3 [3] 1500 GTCTACCACATAGTTGCACAT...GCAATAGAAATTTGTTAAAA ENSMUST00000192857.2 [4] 1500 ACTTAAACACTAAATATGCGG...TTCAAGGATGGCCATGAATT ENSMUST00000161581.3 [5] 1500 TGATTAAGAAAATTCCCTGGT...TTGGTGTGGTAGTCACGTCC ENSMUST00000192183.2 ... ... ... [278371] 1500 CATGCTGACACCCCAATGGGG...AACACTGCAGAAGATGGAGG ENSMUST00020182238.1 [278372] 1500 TGAGAACACTGCAGAAGATGG...ATTAAAGATTGTTTTTTCTC ENSMUST00020182428.1 [278373] 1500 TGACCTTGTAAAACTAGTGGG...AGGACCCTCTGGCCTGAAAG ENSMUST00000381725.1 [278374] 1500 TTCCAGGTCCTACCATGTGAG...TGTGTACACCAGGCTGGCCT ENSMUST00000179505.8 [278375] 1500 CGTTTTTCAGTTTTCTCACCA...TTTTTTTCGAGACTGGGTTT ENSMUST00000178343.2 .. code:: r # choose first 5 PWM as an example pwms <- pwmList[1:5] name(pwms) .. container:: cell-output cell-output-stdout :: MA0004.1 MA0069.1 MA0071.1 MA0074.1 MA0101.1 "Arnt" "PAX6" "RORA" "RXRA::VDR" "REL" .. code:: r # scan for motif hits with 4 cores hits <- findMotifHits(query = pwms, subject = promoterSeqs, min.score = 10.0, method = "matchPWM", BPPARAM = BiocParallel::MulticoreParam(4)) hits .. container:: cell-output cell-output-stdout :: GRanges object with 504274 ranges and 4 metadata columns: seqnames ranges strand | matchedSeq pwmid | [1] ENSMUST00000193812.2 915-924 - | TGGCATTTCC MA0101.1 [2] ENSMUST00000082908.3 768-781 - | TTTATGCATCATAT MA0069.1 [3] ENSMUST00000192857.2 1059-1072 - | TTAATGCATCAGTG MA0069.1 [4] ENSMUST00000192857.2 1090-1099 - | ATTGAGGTCA MA0071.1 [5] ENSMUST00000192183.2 662-671 + | TTCAGGGTCA MA0071.1 ... ... ... ... . ... ... [504270] ENSMUST00000381725.1 644-649 - | CACGTG MA0004.1 [504271] ENSMUST00000179505.8 238-252 + | GGGTCCTAGAGTTTG MA0074.1 [504272] ENSMUST00000179505.8 1333-1342 + | TGGTTTTTCC MA0101.1 [504273] ENSMUST00000178343.2 261-275 + | GGGTCCTAGAGTTTG MA0074.1 [504274] ENSMUST00000178343.2 1356-1365 + | TGGTTTTTCC MA0101.1 pwmname score [1] REL 10.5180 [2] PAX6 10.4507 [3] PAX6 13.8810 [4] RORA 12.6983 [5] RORA 12.3224 ... ... ... [504270] Arnt 11.3550 [504271] RXRA::VDR 12.0611 [504272] REL 10.4383 [504273] RXRA::VDR 12.0611 [504274] REL 10.4383 ------- seqinfo: 278375 sequences from an unspecified genome .. code:: r # we can summarize the number of predicted hits per promoter in matrix format hitsMatrix <- table(factor(seqnames(hits), levels = names(promoterSeqs)), factor(hits$pwmname, levels = name(pwms))) head(hitsMatrix) .. container:: cell-output cell-output-stdout :: Arnt PAX6 RORA RXRA::VDR REL ENSMUST00000193812.2 0 0 0 0 1 ENSMUST00000082908.3 0 1 0 0 0 ENSMUST00000192857.2 0 1 1 0 0 ENSMUST00000161581.3 0 0 0 0 0 ENSMUST00000192183.2 0 0 2 0 1 ENSMUST00000193244.2 0 0 1 0 0 It is good to remember that these are predicted TF binding sites. By making use of additionally available information, like ATAC-seq data, and focusing on accessible regions of the DNA, one could reduce the number of false hits. Ultimately, to find true binding sites for a particular TF, experiments such as ChIP-seq are necessary. Still, as we will see in the section to come, predicted binding sites can be useful to look for TFs that are consistently and robustly enriched. These are TFs that could be playing key roles in our biological system of interest and could be followed up with functional experiments to confirm our findings. Additional resources ==================== The contents of this tutorial were inspired by several available resources which are listed below and serve as additional reading material: - David McKay’s book “Information Theory, Inference, and Learning Algorithms” is a great resource with introductions to key concepts in information theory, as well as deeper dives. - The ``universalmotif`` `Bioconductor package `__ contains additional vignettes, including `explanations <%3Chttps://bioconductor.org/packages/release/bioc/vignettes/universalmotif/inst/doc/IntroductionToSequenceMotifs.pdf>`__ on the discussed motif matrices and how to derive them, as well as additional material. - The ``TFBSTools`` `Bioconductor package `__ vignette found `here `__. Session information =================== .. container:: cell .. code:: r date() .. container:: cell-output cell-output-stdout :: [1] "Wed Sep 24 15:45:07 2025" .. code:: r sessionInfo() .. container:: cell-output cell-output-stdout :: R version 4.5.1 (2025-06-13) Platform: aarch64-apple-darwin20 Running under: macOS Sequoia 15.6.1 Matrix products: default BLAS: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/lib/libRblas.0.dylib LAPACK: /Library/Frameworks/R.framework/Versions/4.5-arm64/Resources/lib/libRlapack.dylib; LAPACK version 3.12.1 locale: [1] en_US.UTF-8/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8 time zone: Europe/Stockholm tzcode source: internal attached base packages: [1] stats4 stats graphics grDevices utils datasets methods [8] base other attached packages: [1] monaLisa_1.14.1 [2] TxDb.Mmusculus.UCSC.mm39.knownGene_3.21.0 [3] GenomicFeatures_1.60.0 [4] AnnotationDbi_1.70.0 [5] Biobase_2.68.0 [6] BSgenome.Mmusculus.UCSC.mm39_1.4.3 [7] BSgenome_1.76.0 [8] rtracklayer_1.68.0 [9] BiocIO_1.18.0 [10] GenomicRanges_1.60.0 [11] RSQLite_2.4.3 [12] JASPAR2024_0.99.7 [13] BiocFileCache_2.16.0 [14] dbplyr_2.5.0 [15] Biostrings_2.76.0 [16] GenomeInfoDb_1.44.0 [17] XVector_0.48.0 [18] IRanges_2.42.0 [19] S4Vectors_0.46.0 [20] BiocGenerics_0.54.0 [21] generics_0.1.4 [22] TFBSTools_1.46.0 loaded via a namespace (and not attached): [1] DBI_1.2.3 bitops_1.0-9 [3] stabs_0.6-4 rlang_1.1.6 [5] magrittr_2.0.3 clue_0.3-66 [7] GetoptLong_1.0.5 matrixStats_1.5.0 [9] compiler_4.5.1 png_0.1-8 [11] vctrs_0.6.5 pwalign_1.4.0 [13] pkgconfig_2.0.3 shape_1.4.6.1 [15] crayon_1.5.3 fastmap_1.2.0 [17] caTools_1.18.3 Rsamtools_2.24.1 [19] rmarkdown_2.29 UCSC.utils_1.4.0 [21] DirichletMultinomial_1.50.0 purrr_1.0.4 [23] bit_4.6.0 xfun_0.52 [25] glmnet_4.1-9 cachem_1.1.0 [27] jsonlite_2.0.0 blob_1.2.4 [29] DelayedArray_0.34.1 BiocParallel_1.42.2 [31] parallel_4.5.1 cluster_2.1.8.1 [33] R6_2.6.1 RColorBrewer_1.1-3 [35] Rcpp_1.1.0 SummarizedExperiment_1.38.1 [37] iterators_1.0.14 knitr_1.50 [39] splines_4.5.1 Matrix_1.7-4 [41] tidyselect_1.2.1 abind_1.4-8 [43] yaml_2.3.10 doParallel_1.0.17 [45] codetools_0.2-20 curl_6.4.0 [47] lattice_0.22-7 tibble_3.3.0 [49] withr_3.0.2 KEGGREST_1.48.1 [51] S7_0.2.0 evaluate_1.0.4 [53] survival_3.8-3 circlize_0.4.16 [55] pillar_1.11.0 filelock_1.0.3 [57] MatrixGenerics_1.20.0 foreach_1.5.2 [59] RCurl_1.98-1.17 ggplot2_4.0.0 [61] scales_1.4.0 gtools_3.9.5 [63] glue_1.8.0 seqLogo_1.74.0 [65] tools_4.5.1 TFMPvalue_0.0.9 [67] GenomicAlignments_1.44.0 XML_3.99-0.18 [69] grid_4.5.1 tidyr_1.3.1 [71] colorspace_2.1-1 GenomeInfoDbData_1.2.14 [73] restfulr_0.0.16 cli_3.6.5 [75] S4Arrays_1.8.1 ComplexHeatmap_2.24.1 [77] dplyr_1.1.4 gtable_0.3.6 [79] digest_0.6.37 SparseArray_1.8.0 [81] rjson_0.2.23 farver_2.1.2 [83] memoise_2.0.1 htmltools_0.5.8.1 [85] lifecycle_1.0.4 httr_1.4.7 [87] GlobalOptions_0.1.2 bit64_4.6.0-1 .. |image1| image:: representingMotifs_files/figure-rst/unnamed-chunk-14-1.png